GGAAUGUUGUCUGGAUCGAGGAU
| Count | Sample ID | Experiment title |
|---|---|---|
| 16 | GSM442932 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |
| 13 | GSM442933 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |
| 8 | GSM605660 | Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0 |
| 6 | GSM605662 | Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0 |
| 5 | GSM605663 | Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0 |
| 4 | GSM491568 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 4 | GSM575246 | Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis |
| 4 | GSM605664 | Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0 |
| 4 | GSM711894 | Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings |
| 3 | GSM343004 | AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing |
| 3 | GSM442935 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |
| 3 | GSM605659 | Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0 |
| 3 | GSM711892 | Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings |
| 2 | GSM491567 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 2 | GSM491578 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 2 | GSM518430 | MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana |
| 2 | GSM575247 | Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis |
| 2 | GSM605661 | Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0 |
| 2 | GSM711891 | Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings |
| 2 | GSM711893 | Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings |
| 1 | GSM284747 | A link between RNA metabolism and silencing affecting Arabidopsis development |
| 1 | GSM284749 | A link between RNA metabolism and silencing affecting Arabidopsis development |
| 1 | GSM415783 | Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs |
| 1 | GSM424848 | Low oxygen responsive small RNAs in Arabidopsis |
| 1 | GSM442934 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |
| 1 | GSM491571 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 1 | GSM491573 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 1 | GSM491574 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 1 | GSM518432 | MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana |
| 1 | GSM518448 | small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues |
| 1 | GSM518455 | small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues |
| 1 | GSM518462 | small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues |
| 1 | GSM605658 | Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0 |
| 1 | GSM605665 | Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0 |
| 1 | GSM707679 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM707688 | Characterization of AGO1-/AGO4-associated smRNAs |