AUCCUCGGACCAGGCUUCAUCCC
Count | Sample ID | Experiment title |
---|---|---|
1 | GSM284749 | A link between RNA metabolism and silencing affecting Arabidopsis development |
1 | GSM424847 | Low oxygen responsive small RNAs in Arabidopsis |
1 | GSM424848 | Low oxygen responsive small RNAs in Arabidopsis |
1 | GSM442932 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |
1 | GSM442933 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |
1 | GSM518444 | small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues |